No lloréis, bichos,
que sufren desengaños
hasta los astros.
Entomología
Webs y blogs sobre entomología
- Buzzing laurustinus. Entrada del 22 de febrero de 2012 a las 17:43 en BugBlog
- I planted a laurustinus (Viburnus tinus) bush on a large pot a couple of years ago and placed it opposite the window where we eat, a sheltered patio area. I did not realised at the time what a great location this was and what a fantastic bug magnet this bush is. One of the best features of (...) Seguir leyendo
- A weird, wingless discovery. Entrada del 22 de febrero de 2012 a las 17:37 en Fall To Climb
- One thing I love about sorting my trap samples is that I never know exactly what I’m going to see! Add to that the novelty of specimens from the far north, and the inherent diversity of insects, and it’s pretty much guaranteed that I’m going to see at least a few new-to-me species every time (...) Seguir leyendo
- Abonado de maduración en el melón. Entrada del 22 de febrero de 2012 a las 08:19 en Homo agricola
- En los melones cuando se acerca la época de la recolección se suele utilizar un abonado que eleve la conductividad, principalmente sulfato de potasio soluble. este abono proporciona una conductividad de 880 mS/cm por cada medio gramo disuelto en un litro de agua. La idea es que al agua le cueste (...) Seguir leyendo
- Condiciones extremas. Entrada del 22 de febrero de 2012 a las 08:18 en Homo agricola
- En nuestro afan por proteger nuestros cultivos, a veces los sometemos a condiciones extremas. En este caso, la sandia está protegida con un tunelillo de plástico, muy bien cerrado por cierto. Con el cambio del tiempo, en las horas centrales del día con el invernadero muy cerrado y el tunelillo aún (...) Seguir leyendo
- Well-Nigh Wordless Wednesday: Before and After. Entrada del 22 de febrero de 2012 a las 08:00 en Dragonfly Woman's Blog
- I’m doing something a little different today and doing a two for one Well-Night Wordless Wednesday! I enjoyed posting the photo of the cattle tank last week (I’ve worked in that one – it’s quite mucky), so this week I … Continue reading (...) Seguir leyendo
- Insect Morphology Seminar – foregut & infrabuccal pouch. Entrada del 22 de febrero de 2012 a las 03:48 en NC State University Insect Museum
- We began our exploration into the insect digestive system with Ann Carr’s lovely presentation on the foregut and the infrabuccal pouch. The infrabuccal pouch is a very neat structure that evolved independently in three orders: Hymenoptera, Isoptera and Coleoptera. It is basically a pocket in the (...) Seguir leyendo
- Ant colonies remember rivals' odor and compete like sports fans. Entrada del 21 de febrero de 2012 a las 18:48 en Insect and Butterfly News
- A new study has shown that weaver ants share a collective memory for the odor of ants in rival nests, and use the information to identify them and compete, similar to how sports fans know each other instantly by their unique (...) Seguir leyendo
- Eat and let die: Insect feeds on toxic plants for protection from predators. Entrada del 21 de febrero de 2012 a las 15:02 en Insect and Butterfly News
- Certain insects, such as the African variegated grasshopper or the cinnabar moth, native in Europe and Asia, feed on toxic plants in order to protect themselves from predators. Seguir leyendo
- Monday Night Mystery: What do these two things have in common?. Entrada del 21 de febrero de 2012 a las 03:58 en Myrmecos Blog
- 1. GCTTAATAAAATTAATTAAATCAGTTTCAAAAATAAGTAGACACGCGTTGTTGTTATTCG 2. Myrmecos points will be awarded to the first person to provide answers to the following questions: What is that bizarre blue landscape? (3 points) To what organism (Genus & species, please) does the DNA sequence belong? (2 (...) Seguir leyendo
- The Purpose of Caddisfly Case Extensions: A Case Study. Entrada del 20 de febrero de 2012 a las 21:48 en Dragonfly Woman's Blog
- Well, Science Sunday ended up getting pushed to Monday, but that’s okay. It happens! But today I’m going to share a fascinatingly simple study with you about caddisflies, so I hope it was worth the wait. I haven’t talked about … Continue reading (...) Seguir leyendo
- LAS COSAS COMO DIOS MANDA. Entrada del 20 de febrero de 2012 a las 20:14 en Homo agricola
- Normal 0 21 No se muy bien como Dios manda hacer las cosas a unagricultor, ni si todas las cosas que manda Dios están bien mandadas. Lacostumbre nos hace repetir frecuentemente la frase que da título al post. Desde luego cuando unove una nueva plantación, como la de las fotografiás que adjunto, (...) Seguir leyendo
- ¿Un retrato desconocido de Mutis?. Entrada del 20 de febrero de 2012 a las 17:34 en Historias de hormigas
- An unknown portrait of Mutis? Hace pocos años dediqué un mes completo a consultar los Archivos del Real Jardín Botánico de Madrid. El objeto de la indagación eran las observaciones sobre hormigas de José Celestino Mutis (1732-1808), Director de la Real Expedición Botánica del Nuevo Reino de Granada. (...) Seguir leyendo
- Insect Morphology Seminar – antennae, gustatory sensilla. Entrada del 20 de febrero de 2012 a las 15:10 en NC State University Insect Museum
- [Guest post by Mauren Turcatel] Andy started the discussion with the paper I chose, about the stereo sense of smell in ants. I explained the behavior experiment described in the paper, about how ants use different points of smell to guide their way to the nest. After the explanation we had some (...) Seguir leyendo
- Tiempo de colmenas. Entrada del 20 de febrero de 2012 a las 15:10 en Homo agricola
- A pesar de las semanas de frio entramos ya en tiempo de colmenas. Una época muy estresante porque dependemos mucho de la suerte. En estos cultivos tan tempranos es preciso dejar que la mata tenga cuerpo antes de meter las abejas. En los tardios se puede adelantar un poco la entrada. Ahora (...) Seguir leyendo
- Grampus and go-devil. Entrada del 20 de febrero de 2012 a las 07:34 en Beetles in the bush
- Ever taken a close look at a female dobsonfly’s head? Female dobsonflys don’t get nearly as much attention as the males due to the latter’s ridiculously elongated mandibles. While female mandibles are more modestly proportioned, don’t think they’re ineffectual—females are quite capable of inflicting (...) Seguir leyendo
- Sunday Night Movie: Dragonflies are the main reason I’m glad not to be a tadpole. Entrada del 20 de febrero de 2012 a las 00:26 en Myrmecos Blog
- Lovely BBC footage of a young dragonfly on the prowl: Seguir leyendo
- Spider Sunday: Featherlegged Orb-weavers. Entrada del 19 de febrero de 2012 a las 15:00 en Bug Eric
- A surprising number of spider families spin the familiar wheel-like webs we see in our yards, gardens, and parks. While most orb webs you see are produced by “ecribellate” spiders that spin glue-studded silk to catch prey, some orbs are spun by “cribellate” spiders that use “hackled,” non-sticky (...) Seguir leyendo
- Science Sunday will be late!. Entrada del 19 de febrero de 2012 a las 09:46 en Dragonfly Woman's Blog
- It’s been a busy week and I finally had a chance to spend a little time to do fun things like running errands with my husband yesterday. As a result, I didn’t finish my blog post and Science Sunday will … Continue reading → Seguir leyendo
- Preparados para la edad del hielo. Entrada del 19 de febrero de 2012 a las 09:43 en Homo agricola
- "La supervivencia diferencia al dodó de la bestia". Las "bestias" seguimos aquí mientras le van quitando el agua al pez igual que en aquellas feroces luchas contra las guerrilas sudamericanas en las que el objetivo era destruir el apoyo social. Aquí el agua del pez es un precio rentable, que por (...) Seguir leyendo
- Strumigenys, oh Strumigenys, I give in.. Entrada del 19 de febrero de 2012 a las 01:32 en Myrmecos Blog
- Remember the myrmecological disagreement over maintaining Pyramica as a separate genus from the similar Strumigenys? After fulminating on the issue for some months, I’ve decided to throw my lot in with the synonomy. I give up. They’re all just Strumigenys. I have updated my galleries accordingly. (...) Seguir leyendo
Entomoblog es un blog creado con SPIP y alojado en Dinahosting. El contenido y algunas imágenes están bajo la licencia Creative Commons.